View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10932_low_21 (Length: 250)
Name: NF10932_low_21
Description: NF10932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10932_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 13 - 241
Target Start/End: Original strand, 32682481 - 32682711
Alignment:
| Q |
13 |
ctttgcgatctgtataaatggctgctgaaacttcagtgattttggtatttatagaatccaaatccagtgtttttgaaaaacaacataaatagaca--act |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
32682481 |
ctttgcgatctgtataaatggctgctgaaacttcagtgattttggtatttagagaatccaaatccagtgtttttgaaaaacaacataaatagacacaact |
32682580 |
T |
|
| Q |
111 |
ttctggtctgtctgaatggtaagttgaagtatgaatgaggaactgatttggctggataatggattgcatcattttgtagtgtctagtctgttttgcatat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32682581 |
ttctggtctgtctgaatggtaagttgaagtatgaatgaggaactgattgggctggataatggattgcatcattttgtagtgtctagtctgttttgcatat |
32682680 |
T |
|
| Q |
211 |
tttgtagttcttttgaaacacacattcttct |
241 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |
|
|
| T |
32682681 |
tttgtagtccttttgaaacacacattcttct |
32682711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University