View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10932_low_26 (Length: 224)
Name: NF10932_low_26
Description: NF10932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10932_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 10 - 206
Target Start/End: Complemental strand, 4521618 - 4521426
Alignment:
| Q |
10 |
gagatgaacatggtgctttaatttcatgttaaatttgatcattttgcgttgaagtgtgag-tgcatattggtgaagcatttggattcagctcgtaattga |
108 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
4521618 |
gagatgaacatggtgcttt-----catgttaaatttgatcattttgcgttgaagtgtgaggtgcatattggtgaagcttttagattcagctcgtaattga |
4521524 |
T |
 |
| Q |
109 |
gttcttgagtttaatttgggacttttagactttgaatttgatgctaaggtggtggttgagagcttctcattcaatcggaaaaatttgaatgatttcag |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4521523 |
gttcttgagtttaatttgggacttttagactttgaatttgatgctaaggtggtggtcgagagcttctcattcaatcagaaaaatttgaatgatttcag |
4521426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University