View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10934_low_7 (Length: 262)
Name: NF10934_low_7
Description: NF10934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10934_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 19 - 253
Target Start/End: Complemental strand, 3287476 - 3287242
Alignment:
| Q |
19 |
ggtgtgcatacaacaattttcatggaatagaaacttgcattgtataaacatgactggcccaattgtttggcccaataaaggaagaaagttgctaaaacac |
118 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3287476 |
ggtgtgcatacaacaattttcatagaatagaaacttgcattgtataaacatgactggcccaattgtttggcccaataaaggaagaaaggtgctaaaacac |
3287377 |
T |
 |
| Q |
119 |
ggattaagagaagacgatgtggtacaaaaactattctcaatgccatatacttatataaagattcgagaaaatctgacttgtctccaccactcaacacacc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3287376 |
ggattaagagaagacgatgtggtacaaaaactattctcaatgccatatacttatataaagattcgagaaaatctgacttgtctccaccactcaacacacc |
3287277 |
T |
 |
| Q |
219 |
agggaactcatctaactcacaaaactgtcttcatc |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
3287276 |
agggaactcatctaactcacaaaactgtcttcatc |
3287242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University