View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10935_high_10 (Length: 206)
Name: NF10935_high_10
Description: NF10935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10935_high_10 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 90 - 206
Target Start/End: Original strand, 9733636 - 9733752
Alignment:
| Q |
90 |
aatgaaaatcaaagatcacttttttgtttaactcatttgatttcacttgttgaagctgcaaaaccaaaaccaactttttgaagagttgtttttcacttcc |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9733636 |
aatgaaaatcaaagatcacttttttgtttaactcatttgatttcacttgttgaagctgcaaaaccaaaaccaactttttgaagagttgtttttctcttcc |
9733735 |
T |
|
| Q |
190 |
ttcctttaggtgatgtc |
206 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
9733736 |
ttcctttaggtgatgtc |
9733752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University