View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10935_low_11 (Length: 214)
Name: NF10935_low_11
Description: NF10935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10935_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 71 - 204
Target Start/End: Complemental strand, 12666350 - 12666217
Alignment:
| Q |
71 |
ttgattttgaattggaattggatttagggttagggtatggagtggaggtgcgtggtgtaacgaagctacagtgcggttggtgttggtagtggtggtggtt |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12666350 |
ttgattttgaattggaattggatttagggttagggtatggagtggaggtgcgtggtgtaacgaagctacagtgcggttggtgttggtagtggtggtggtg |
12666251 |
T |
|
| Q |
171 |
atgaagatttatgtgatattgttgtttgtgatgt |
204 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
12666250 |
atgaagatttatgtgatattgttgttggtgatgt |
12666217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 71 - 204
Target Start/End: Original strand, 667963 - 668096
Alignment:
| Q |
71 |
ttgattttgaattggaattggatttagggttagggtatggagtggaggtgcgtggtgtaacgaagctacagtgcggttggtgttggtagtggtggtggtt |
170 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
667963 |
ttgattttgaattggaattggaattagggttagggtatggagtggaggtgcgtggtgtaacgaagctacagtgcggttggtgttgatagtggtggtggtg |
668062 |
T |
|
| Q |
171 |
atgaagatttatgtgatattgttgtttgtgatgt |
204 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
668063 |
atgaagatttatgtgatattgttgttggtgatgt |
668096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 89 - 168
Target Start/End: Complemental strand, 21913970 - 21913891
Alignment:
| Q |
89 |
tggatttagggttagggtatggagtggaggtgcgtggtgtaacgaagctacagtgcggttggtgttggtagtggtggtgg |
168 |
Q |
| |
|
|||| ||||||||||||| |||||||| ||||||||||| |||| || || ||| || ||||||||| |||||||||| |
|
|
| T |
21913970 |
tggagttagggttagggtttggagtggtggtgcgtggtggaacggagagacggtgggggcggtgttggtggtggtggtgg |
21913891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University