View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10935_low_11 (Length: 214)

Name: NF10935_low_11
Description: NF10935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10935_low_11
NF10935_low_11
[»] chr1 (1 HSPs)
chr1 (71-204)||(12666217-12666350)
[»] chr7 (1 HSPs)
chr7 (71-204)||(667963-668096)
[»] chr6 (1 HSPs)
chr6 (89-168)||(21913891-21913970)


Alignment Details
Target: chr1 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 71 - 204
Target Start/End: Complemental strand, 12666350 - 12666217
Alignment:
71 ttgattttgaattggaattggatttagggttagggtatggagtggaggtgcgtggtgtaacgaagctacagtgcggttggtgttggtagtggtggtggtt 170  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
12666350 ttgattttgaattggaattggatttagggttagggtatggagtggaggtgcgtggtgtaacgaagctacagtgcggttggtgttggtagtggtggtggtg 12666251  T
171 atgaagatttatgtgatattgttgtttgtgatgt 204  Q
    |||||||||||||||||||||||||| |||||||    
12666250 atgaagatttatgtgatattgttgttggtgatgt 12666217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 71 - 204
Target Start/End: Original strand, 667963 - 668096
Alignment:
71 ttgattttgaattggaattggatttagggttagggtatggagtggaggtgcgtggtgtaacgaagctacagtgcggttggtgttggtagtggtggtggtt 170  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||     
667963 ttgattttgaattggaattggaattagggttagggtatggagtggaggtgcgtggtgtaacgaagctacagtgcggttggtgttgatagtggtggtggtg 668062  T
171 atgaagatttatgtgatattgttgtttgtgatgt 204  Q
    |||||||||||||||||||||||||| |||||||    
668063 atgaagatttatgtgatattgttgttggtgatgt 668096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 89 - 168
Target Start/End: Complemental strand, 21913970 - 21913891
Alignment:
89 tggatttagggttagggtatggagtggaggtgcgtggtgtaacgaagctacagtgcggttggtgttggtagtggtggtgg 168  Q
    |||| ||||||||||||| |||||||| ||||||||||| |||| ||  || ||| ||  ||||||||| ||||||||||    
21913970 tggagttagggttagggtttggagtggtggtgcgtggtggaacggagagacggtgggggcggtgttggtggtggtggtgg 21913891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University