View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10935_low_3 (Length: 422)
Name: NF10935_low_3
Description: NF10935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10935_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 263; Significance: 1e-146; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 65 - 406
Target Start/End: Complemental strand, 4444982 - 4444638
Alignment:
| Q |
65 |
gtgagtttcttagagggatgatgttgacaaacaaggaattagcaatgatcattaacgacaataaacagaagaggcctctgtgtgtccggtgactctaact |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4444982 |
gtgagtttcttagagggatgatgttgacaaacaaggaa---gcaatgatcattaacgacaataaacagaagaggcctc-gtgtgtccggtgactctaact |
4444887 |
T |
 |
| Q |
165 |
gtgtaacttcgcaacctctaacaaattactcttttgtcaacaaagcagccgcaaacgtggctttttgaaatgaatgaaaaaacattcaagaatccctttt |
264 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||| |||||||||||||||||||||||| | |
|
|
| T |
4444886 |
gtgtaactttgcaacctctaacaaattactcttttgtcaacaacgcagccgcaaacgtggctttt-gaaatgactgaaaaaacattcaagaatcccttct |
4444788 |
T |
 |
| Q |
265 |
tcccggttgatttcgatacttactgatcgttagcagtcgggtaggtcttttgtt--------tttgagacaatgctattgcctatgcatccaagggttat |
356 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4444787 |
tcccagttgatttcgatacttactgatcgttagcagtcgggtaagtcttttgtttttgggtttttgagacaatgctattgcctatgcatccaagggttat |
4444688 |
T |
 |
| Q |
357 |
cccattttgtgactcaatcaaaccaattgagacagcagcaaccaagtttg |
406 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4444687 |
ccctttttgtgactcaatcaaaccaattgagacagcagcaaccaagtttg |
4444638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 4445052 - 4445016
Alignment:
| Q |
1 |
gaaaaatcaaacaatggaaggaaacaagactatggtt |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4445052 |
gaaaaatcaaacaatggaaggaaacaagactatggtt |
4445016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 59; Significance: 7e-25; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 316 - 406
Target Start/End: Original strand, 37558671 - 37558761
Alignment:
| Q |
316 |
gtttttgagacaatgctattgcctatgcatccaagggttatcccattttgtgactcaatcaaaccaattgagacagcagcaaccaagtttg |
406 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
37558671 |
gtttttgaggtaatgctattgcctatgcatccaagggttatcccttttttggactcaatcaaaccaattgaagcagcagcaaccaggtttg |
37558761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 165 - 296
Target Start/End: Original strand, 37558480 - 37558610
Alignment:
| Q |
165 |
gtgtaacttcgcaacctctaacaaattactcttttgtcaacaaagcagccgcaaacgtggctttttgaaatgaatgaaaaaacattcaagaatccctttt |
264 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||||| ||||| | | |||| ||| |||||| ||||||| || ||||| ||||||| | |
|
|
| T |
37558480 |
gtgtaacttcgcaacctctaccaaattattcttttgtcaacaatgcagctgtggagttggc-tttcaaaatgactgaaaaatcactcaaggatcccttct |
37558578 |
T |
 |
| Q |
265 |
tcccggttgatttcgatacttactgatcgtta |
296 |
Q |
| |
|
|||| |||||||| |||||||| || |||||| |
|
|
| T |
37558579 |
tcccagttgatttggatacttattgttcgtta |
37558610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 316 - 364
Target Start/End: Original strand, 34257710 - 34257758
Alignment:
| Q |
316 |
gtttttgagacaatgctattgcctatgcatccaagggttatcccatttt |
364 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||| ||||||||| |||| |
|
|
| T |
34257710 |
gtttttgaagcaatgctattgcctacgcatccaacggttatcccgtttt |
34257758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University