View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10935_low_5 (Length: 341)
Name: NF10935_low_5
Description: NF10935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10935_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 73 - 308
Target Start/End: Original strand, 9733636 - 9733871
Alignment:
| Q |
73 |
aatgaaaatcaaagatcacttttttgtttaactcatttgatttcacttgttgaagctgcaaaaccaaaaccaactttttgaagagttgtttttcacttcc |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9733636 |
aatgaaaatcaaagatcacttttttgtttaactcatttgatttcacttgttgaagctgcaaaaccaaaaccaactttttgaagagttgtttttctcttcc |
9733735 |
T |
|
| Q |
173 |
ttcctttaggtgatgtcgttgtctttgattgtttctcccaaaagaacctgaacgaatccacgttaccaacttgccaacgttgttgcttttttctgctctt |
272 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9733736 |
ttcctttaggtgatgtctttgtctttgattgtttctcccaaaagaacctgaacgaatccacgttaccaacttgccaacgttgttgcttttttctgctctt |
9733835 |
T |
|
| Q |
273 |
gtttcataataatgttgcagttcttcacagtgctgt |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
9733836 |
gtttcataataatgttgcagttcttcacagtgctgt |
9733871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University