View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10935_low_7 (Length: 254)
Name: NF10935_low_7
Description: NF10935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10935_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 19 - 236
Target Start/End: Complemental strand, 42494344 - 42494137
Alignment:
| Q |
19 |
aaactgtggttgtttttgtatttctcaaatatcaatgaataacaaagaataaaacaataacttgctacagaatttctagaagtgagactgttggccatct |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42494344 |
aaactgtggttgtttttgtatttctcaaatatcaa----------agaataaaacaataacttgctacagaatttctagaagtgagactgttggccatct |
42494255 |
T |
 |
| Q |
119 |
cagaaatatgcaaaacctaagagcttaagtgaagaaaagatagtagcaagcctttaactagagaacatgaggtagtaaagtactttggtaaaaagttggt |
218 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42494254 |
cacaaatatgcaaaacctaagagcttaagtgaagaaaagatagtagcaagcctttaactagagaacatgaggtagtaaagtactttggtaaaaagttggt |
42494155 |
T |
 |
| Q |
219 |
aatgcacttggtttaaaa |
236 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
42494154 |
aatgcacttggtttaaaa |
42494137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University