View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10936_low_11 (Length: 249)
Name: NF10936_low_11
Description: NF10936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10936_low_11 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 12 - 249
Target Start/End: Original strand, 28883512 - 28883750
Alignment:
| Q |
12 |
agagagagggaaaccaattctgttgcaatttatgaacaagaaataacgagatccggatacacgtttatgacagaagtgggccccatcgaaagtagca-at |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||| || |
|
|
| T |
28883512 |
agagagagggaaaccaattctgttgcaatttatgaacaagaaataacgagatccggatccacgtttattacagaagtgggccccatcgaaagtagcagat |
28883611 |
T |
 |
| Q |
111 |
ttcatttcaatttcaatctgcattgataaacaaaaccggaacagaattttccgtcaccgacgaagatgctgccaaatctccgatcccggcgacgcccccg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28883612 |
ttcatttcaatttcaatctgcattgataaacaaaaccgcaacagaattttccgtcaccgacgaagatgctgccaaatctccgatcccggcgacgcccccg |
28883711 |
T |
 |
| Q |
211 |
ttacggaggccttctatgtgccgttgtttcagcacttct |
249 |
Q |
| |
|
|||||| |||||||||| || || |||||||||||||| |
|
|
| T |
28883712 |
ttacggcagccttctatgcgctgtcgtttcagcacttct |
28883750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University