View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10936_low_5 (Length: 471)
Name: NF10936_low_5
Description: NF10936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10936_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 116; Significance: 8e-59; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 116; E-Value: 8e-59
Query Start/End: Original strand, 70 - 209
Target Start/End: Original strand, 42648159 - 42648298
Alignment:
| Q |
70 |
atctcatatatcattaaaatctcatgagaaggcgggatcccccggggattctactgagggtttagcatatcgcaaagctaatggggaaacaaagtatata |
169 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||| |||||||||||||||||||||||||||| |||||||||||||| |||||| |||||| |
|
|
| T |
42648159 |
atctcatatatcattaaaatctcgtgagaagacgggatcccctggggattctactgagggtttagcatatcacaaagctaatggggcaacaaaatatata |
42648258 |
T |
|
| Q |
170 |
gattcacgtggggcatcatctgggtcagattctgtgagag |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42648259 |
gattcacgtggggcatcatctgggtcagattctgtgagag |
42648298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 111; E-Value: 8e-56
Query Start/End: Original strand, 337 - 455
Target Start/End: Original strand, 42648811 - 42648929
Alignment:
| Q |
337 |
attcatcccctattttgcggataggggactttaattttgatattctggagatgtgttttatagagctggttaaataatttgcaaacgagacttaatttct |
436 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42648811 |
attcatcccctgttttgcggataggggactttaattttgatattctggagatgtgttttatagagctggttaaataatttgcaaacgagacttaatttct |
42648910 |
T |
|
| Q |
437 |
tttatgccttggtactgtt |
455 |
Q |
| |
|
||||||||| ||||||||| |
|
|
| T |
42648911 |
tttatgcctcggtactgtt |
42648929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 265 - 341
Target Start/End: Original strand, 42648678 - 42648754
Alignment:
| Q |
265 |
ttggagttgcttaaggattactgctaaatttgacttacatcattagattaaagaattatgacaaactgccaaattca |
341 |
Q |
| |
|
|||||||| ||||| | ||||| |||||||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42648678 |
ttggagttacttaaaggttacttctaaatttaacttgcatcattagattaaagaattatgacaaactgccaaattca |
42648754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 14 - 53
Target Start/End: Original strand, 42648083 - 42648122
Alignment:
| Q |
14 |
aggcatcactgtacttgaagaaagatggctctgataaagg |
53 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42648083 |
aggcatcactgtacttcaagaaagatggctctgataaagg |
42648122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University