View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10938_low_12 (Length: 235)
Name: NF10938_low_12
Description: NF10938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10938_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 10 - 214
Target Start/End: Complemental strand, 44375484 - 44375280
Alignment:
| Q |
10 |
ggagaagcagagacactaatacaagtctcccatacttttaacatatacaggttttataatgtgactatcaacattgggtacccaccaaggccatattttc |
109 |
Q |
| |
|
|||||| || |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44375484 |
ggagaaccaaagacactaatacaaatctcccatacttttaacatatacaggttttataatgtgactatcaacattgggtacccaccaaggccatattttc |
44375385 |
T |
 |
| Q |
110 |
ttgatattgacactggtagcgacctaacatggcttcaatgtgatgcaccttgttcccgttgctctcaggtatgaatctcactcactttactcattgccaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44375384 |
ttgatattgacactggtagcgacctaacatggcttcaatgtgatgcaccttgttcccgttgctctcaggtatgaatctcactcactttactcattgccaa |
44375285 |
T |
 |
| Q |
210 |
cattc |
214 |
Q |
| |
|
||||| |
|
|
| T |
44375284 |
cattc |
44375280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 57 - 166
Target Start/End: Complemental strand, 39498485 - 39498376
Alignment:
| Q |
57 |
caggttttataatgtgactatcaacattgggtacccaccaaggccatattttcttgatattgacactggtagcgacctaacatggcttcaatgtgatgca |
156 |
Q |
| |
|
|||||| |||||||| ||| ||||||| || | ||||||||||| |||||||||||| ||||||| ||||| || || |||||||| ||||||||||| |
|
|
| T |
39498485 |
caggttctataatgttactctcaacataggccaaccaccaaggccctattttcttgatgttgacaccggtagtgaactcacatggctccaatgtgatgct |
39498386 |
T |
 |
| Q |
157 |
ccttgttccc |
166 |
Q |
| |
|
|||||||||| |
|
|
| T |
39498385 |
ccttgttccc |
39498376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University