View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10939_high_8 (Length: 330)
Name: NF10939_high_8
Description: NF10939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10939_high_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 5 - 220
Target Start/End: Complemental strand, 34234445 - 34234221
Alignment:
| Q |
5 |
gagaagcagagattaccaaaaaa-caatacaacaattgttcnnnnnnn-gcgattaaagaggtgcaaacatagaaacataatttgaattttgagtaaaat |
102 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34234445 |
gagaagtagagattaccaaaaaaacaatacaacaattgttcaaaaaaaagcgattaaagaggtgcaaacatagaaacataatttgaattttgagtaaaat |
34234346 |
T |
|
| Q |
103 |
tacttgaaaccctaaattgttnnnnnnnn-------tgaattgtaactcaaatttggggggaaacggtagagaaattgattgaattgagagaaatggtac |
195 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34234345 |
tacttgaaaccctaaattgttaaaaaaaaataaaaatgaattgtaacacaaatttggggggaaacggtagagaaattgattgaattgagagaaatggtac |
34234246 |
T |
|
| Q |
196 |
atagatcttagctggaagtagctac |
220 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
34234245 |
atagatcttagctggaagtagctac |
34234221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 281 - 313
Target Start/End: Complemental strand, 34234160 - 34234128
Alignment:
| Q |
281 |
gttaagattcgtgggaatctgaggagcgaagtg |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
34234160 |
gttaagattcgtgggaatctgaggagcgaagtg |
34234128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University