View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1093_high_21 (Length: 201)
Name: NF1093_high_21
Description: NF1093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1093_high_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 20 - 181
Target Start/End: Original strand, 43144267 - 43144428
Alignment:
| Q |
20 |
ataatagtagtaaaattatgaatagttggactcaaataattaataatagctttttatttgagtatgggttgtaattaaggatacgttaattagtgattaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43144267 |
ataatagtagtaaaattatgaatagttggactcaaataattaataatagctttttatttgagtatgggttgtaattaaggatacgttaattagtgattaa |
43144366 |
T |
|
| Q |
120 |
atgaagttttgggtaatttataatagtagacgtgattaatttggcagaaacaaagttggatg |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| || || |||||||| |
|
|
| T |
43144367 |
atgaagttttgggtaatttataatagtagacgtgattaatttggcaggaaaaacgttggatg |
43144428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University