View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1093_low_15 (Length: 431)
Name: NF1093_low_15
Description: NF1093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1093_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 96 - 422
Target Start/End: Complemental strand, 50710276 - 50709941
Alignment:
| Q |
96 |
tatcctcacaacatactcatcatattctcgtcggcaaaacttcatcgtctcacaaagtgatcgaagcaacaacagtcattttctcaatatacatctcact |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
50710276 |
tatcctcacaacatactcatcatattctcgtcggcaaaacttcatcgtctcacaaagtgatcgaagcaacaacagtcattttctcaatatacat----ct |
50710181 |
T |
|
| Q |
196 |
caaccgccataaaactctatatgaataaaaactcttctcaacacttatgatcaaacataggt-----------atgttcaacgcatgacttggctttcta |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
50710180 |
caaccgccataaaactctatatgaataaaaactcttctcaacatttatgatcaaacataggtatcttcaatgaatgttcaacgcatgacttggctttcta |
50710081 |
T |
|
| Q |
285 |
aatgattct-ctcatgcaattcaccaaacacaattgtatgttcatttggaagcat-ctctttatatgtacatataaaatcactttgatgtgcccctttgg |
382 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||||||||| ||||||| ||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
50710080 |
aatgattctcctcatgcaattcaccaaacacaattgcatgttcatttcgaagcatcctctttatatgtacatataaaatcactttgatgcgcccctttgg |
50709981 |
T |
|
| Q |
383 |
ctcaataccctagcataaggcttaggattcccgcctatga |
422 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
50709980 |
ctcaataccctagcataaggcttaggatttccgcctatga |
50709941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University