View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1093_low_32 (Length: 269)
Name: NF1093_low_32
Description: NF1093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1093_low_32 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 30 - 269
Target Start/End: Original strand, 12451599 - 12451838
Alignment:
| Q |
30 |
tttttcactcatatgtgtaaaatttgtgtggcagattattgatgcaaataaaggtggtgtggtggcggaagttgaaggccttaagggatttgttccattc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12451599 |
tttttcactcatatgtgtaaaatttgtgtggcagattattgatgcaaataaaggtggtgtggtggctgaagttgaaggccttaagggatttgttccattc |
12451698 |
T |
|
| Q |
130 |
tcacagatgtcaacggttagctctttacctactttgatatttatgaacttacatgcattgaatcaaaacttgtcatttggcaagtaaaaaagctacaatg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12451699 |
tcacagatgtcaacggttagctctttacctactttgatatttatgaacttacatgcattgaatcaaaacttgtcatttggcaagtaaaaaagctacaatg |
12451798 |
T |
|
| Q |
230 |
gctattgagagaaacggtgtaaacaacctaactctgatga |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12451799 |
gctattgagagaaacggtgtaaacaacctaactctaatga |
12451838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University