View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1093_low_33 (Length: 256)
Name: NF1093_low_33
Description: NF1093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1093_low_33 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 56 - 256
Target Start/End: Complemental strand, 32183257 - 32183057
Alignment:
| Q |
56 |
ctaatctaacaactaactactaatatttgccattcnnnnnnnnngtttaggtctgaaaaggtaccttcacttgaatctgcaagtatttaacatagtcaat |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32183257 |
ctaatctaacaactaactactaatatttgccattcaaaaaaatagtttaggtctgaaaaggtaccttcacttgaatctgcaagtatttaacatagtcaat |
32183158 |
T |
 |
| Q |
156 |
gatatcatccaatatgtaagcttgactaccctgcaaattaaaattcaacgtatatgagctacttaaatttggtcccaaaaaattagctacttaaataact |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32183157 |
gatatcatccaatatgtaagcttgactaccctgcaaattaaaattcaacatatatgagctacttaaatttggtcccaaaaaattagctacttaaataact |
32183058 |
T |
 |
| Q |
256 |
t |
256 |
Q |
| |
|
| |
|
|
| T |
32183057 |
t |
32183057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 56 - 89
Target Start/End: Original strand, 32398798 - 32398831
Alignment:
| Q |
56 |
ctaatctaacaactaactactaatatttgccatt |
89 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
32398798 |
ctaatctaacaactaattactaatatttgccatt |
32398831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University