View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1093_low_34 (Length: 249)
Name: NF1093_low_34
Description: NF1093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1093_low_34 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 12452064 - 12452310
Alignment:
| Q |
1 |
cccttttgcctattttctctgtagaaatcaccgggagaagagattattgagtttgaggttcctctaaagtttgtggaggtggaccaggaacaagccagac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12452064 |
cccttttgcctattttctctgtagaaatcaccgggagaagagattattgagtttgaggttcctctaaagtttgtggaggtggaccaggaacaagctagac |
12452163 |
T |
|
| Q |
101 |
ttgtccttagccaccgcaaagccgtagccggcatccaaggacaactaggaattggatcagttgtcaccggcactgtgcaaagcctaaagccatatggtgc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
12452164 |
ttgtccttagccaccgcaaagccgtagccggcatccaaggacaactaggaattggatcagttgtcactggcactgtgcaaagcctaaagccatatggtgc |
12452263 |
T |
|
| Q |
201 |
ctttatcgacattggtggtggaatcagtggccttcttcatgtcagtc |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12452264 |
ctttatcgacattggtggtggaatcagtggccttcttcatgtcagtc |
12452310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University