View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10940_low_16 (Length: 244)
Name: NF10940_low_16
Description: NF10940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10940_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 61; Significance: 3e-26; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 179 - 239
Target Start/End: Complemental strand, 6564655 - 6564595
Alignment:
| Q |
179 |
tagtttgccgttttttgaaggaagtttgattgattacctgaagagtggtgtgctctctgct |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6564655 |
tagtttgccgttttttgaaggaagtttgattgattacctgaagagtggtgtgctctctgct |
6564595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 6564847 - 6564789
Alignment:
| Q |
1 |
tacttatcatatccaaatgacgggagtccagttcctcggggccgaagggtaagaccaac |
59 |
Q |
| |
|
|||||||||||||||||| ||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6564847 |
tacttatcatatccaaattacgagagtccatttcctcggggccgaagggtaagaccaac |
6564789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 74 - 117
Target Start/End: Complemental strand, 6564761 - 6564718
Alignment:
| Q |
74 |
aaccttaaatggtcatttgtttcttaagaccttacaatcaaacc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6564761 |
aaccttaaatggtcatttgtttcttaagaccttacaatcaaacc |
6564718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University