View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10940_low_21 (Length: 207)
Name: NF10940_low_21
Description: NF10940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10940_low_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 144; Significance: 6e-76; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 144; E-Value: 6e-76
Query Start/End: Original strand, 42 - 185
Target Start/End: Complemental strand, 13879675 - 13879532
Alignment:
| Q |
42 |
gatgatgatgatcttgttctctgggattttacggagactgaggagtctgtgattttgcggtcgaatcttgtcgctgacaacgtgaggaaggaagagattg |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13879675 |
gatgatgatgatcttgttctctgggattttacggagactgaggagtctgtgattttgcggtcgaatcttgtcgctgacaacgtgaggaaggaagagattg |
13879576 |
T |
|
| Q |
142 |
atgtctgtgttgatcacggtactctcaggattgaggatgttctt |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13879575 |
atgtctgtgttgatcacggtactctcaggattgaggatgttctt |
13879532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 52 - 185
Target Start/End: Complemental strand, 13875448 - 13875315
Alignment:
| Q |
52 |
atcttgttctctgggattttacggagactgaggagtctgtgattttgcggtcgaatcttgtcgctgacaacgtgaggaaggaagagattgatgtctgtgt |
151 |
Q |
| |
|
||||||||||||| |||||| |||||| ||||||||| ||||||| |||| |||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
13875448 |
atcttgttctctgtgattttgaggagaccgaggagtctttgatttttcggttgaatctggtcgccaacaacgtgaggaaggaagagattgatgtctgtgt |
13875349 |
T |
|
| Q |
152 |
tgatcacggtactctcaggattgaggatgttctt |
185 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||| |
|
|
| T |
13875348 |
tgatcacggtactctcaggattaaggatgctctt |
13875315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University