View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10941_low_4 (Length: 338)
Name: NF10941_low_4
Description: NF10941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10941_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 11 - 202
Target Start/End: Complemental strand, 38952057 - 38951865
Alignment:
| Q |
11 |
cagagaccgtgattgttaaatgaagtagctaattgaaaatctttcttcatgaatcttt-gcatgctgtgcataatttataaggaagaagcgtggacgaca |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38952057 |
cagagaccgtgattgttaaatgaagtagctaattgaaaatctttcttcatgaatcttttgcatgctgtgcataatttataaggaagaagcgtggacgaca |
38951958 |
T |
 |
| Q |
110 |
agaaataaagccatggtcccctcaccactgattccagctaatagcacgtaggcaagaattgcaatgcagacaatcatgctctttgtttggtta |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38951957 |
agaaataaagccatggtcccctcaccactgattccagctaatagcacgtaggcaagaattgcaatgcagacaatcatgctctttgtttggtta |
38951865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 202 - 338
Target Start/End: Complemental strand, 38951840 - 38951703
Alignment:
| Q |
202 |
agagcatatgtgtaacacacaaggcttccatagccatgcaagctgaagaatgtctaatgctcagcaccccacctgctttaacgtgtccattcatcaccat |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38951840 |
agagcatatgtgtaacacacaaggcttccatagccatgcaagctgaagaatgtctaatgctcagcaccccacctgctttaacgtgtccattcatcaccat |
38951741 |
T |
 |
| Q |
302 |
tctcacttccc-tataaattaccagttctcattgaggt |
338 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38951740 |
tctcacttcccttataaattaccagttctcattgaggt |
38951703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 219 - 265
Target Start/End: Complemental strand, 38944337 - 38944291
Alignment:
| Q |
219 |
cacaaggcttccatagccatgcaagctgaagaatgtctaatgctcag |
265 |
Q |
| |
|
|||| ||||| |||||||||||| | ||||||||||||||||||||| |
|
|
| T |
38944337 |
cacatggctttcatagccatgcacgatgaagaatgtctaatgctcag |
38944291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University