View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10942_high_28 (Length: 224)

Name: NF10942_high_28
Description: NF10942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10942_high_28
NF10942_high_28
[»] chr6 (1 HSPs)
chr6 (29-210)||(1330115-1330296)


Alignment Details
Target: chr6 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 29 - 210
Target Start/End: Complemental strand, 1330296 - 1330115
Alignment:
29 tacttcggttctcaataaaatatttggtatgttttttcttatatgatttcaaggagttggtgtttctcctaataaagagaattttgttgaagtttatgag 128  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1330296 tacttcggttctcaataaaatatttggtatgttttttcttatatgatttcaaggagttggtgtttctcctaataaagagaattttgttgaagtttatgag 1330197  T
129 gatgaaaataatggggttattagctacgggttaagatggtggaaaaattggcaaagaaattcatggttgttatcttctctgc 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1330196 gatgaaaataatggggttattagctacgggttaagatggtggaaaaattggcaaagaaattcatggttgttatcttctctgc 1330115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University