View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10942_low_12 (Length: 411)
Name: NF10942_low_12
Description: NF10942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10942_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 228; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 228; E-Value: 1e-125
Query Start/End: Original strand, 18 - 332
Target Start/End: Complemental strand, 41944795 - 41944482
Alignment:
| Q |
18 |
agcaaagtgatggactaagttgtacatttacaagtaggtaggtatcaaaccttcttccttttcatcacttcacttatctcatctactattccacccaatc |
117 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
41944795 |
agcaaagtgatggactaagctgtacatttacaggtaggtaggtatcaaaccttcttccttttcatcacttcacttatctcatctactattcaacccaatc |
41944696 |
T |
 |
| Q |
118 |
aaagcttctataatagttgcacctatgcaacatctattgagagttacattggctagcttcaatgtattggannnnnnnnnnnnnnnnnggtctcttagtg |
217 |
Q |
| |
|
|||||||||| |||||||||||| || |||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
41944695 |
aaagcttctacaatagttgcacc-atacaacatctattgagagttacattggctagcttcaatgtattggatttttcttttcctttttggtctcttagtg |
41944597 |
T |
 |
| Q |
218 |
cggaggtccaaggagagtctgcgtgcaagtgtaatactgtctcattccgtcatatgttgcgacaaccgattatccgtcacagagctctaaaatctatcat |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41944596 |
cggaggtccaaggagagtctgcgtgcaagtgtaatactgtctcattccgtcataggttgcgacaaccgtttatccgtcacagagctctaaaatctatcat |
41944497 |
T |
 |
| Q |
318 |
ggaactaaggcaaat |
332 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
41944496 |
ggaactaaggcaaat |
41944482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University