View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10942_low_15 (Length: 373)
Name: NF10942_low_15
Description: NF10942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10942_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 11 - 359
Target Start/End: Original strand, 38838894 - 38839240
Alignment:
| Q |
11 |
cagagatgaggtagacctagcgtattcttagtatctagatcaatcatgtgttaggagaggaggattgaggcgtttgtgtcgacaaactatgggatactgc |
110 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
38838894 |
cagagatgatgtagacctagcgtattcttagtatctagatcaatcatgtgttaggagaggaggattgaggcgtttgtgtcgtcaacctatgggatactgc |
38838993 |
T |
|
| Q |
111 |
acttagatatatgcgcggtggtatttcaaatacattatctcacttatttaatggagggactgggttacacatgagagnnnnnnnctggagacaatctcct |
210 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||||||||| ||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
38838994 |
acttagatatatgcct--tggtatttcaaatacattatttcacttatttattggagggcctgggttacacatgagagaaaaaaactggagacaatctcct |
38839091 |
T |
|
| Q |
211 |
cccttacctattatccaaacttgaaggagggcaaatgaagccatctgaagaaggttgcagtggcagcaccacatgagcatagaggtactcccgcagactt |
310 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38839092 |
cccttacctattatccatacttgaaggagggcaaatgaagccatctgaagaaggttgcagtggcagcaccacatgagcatagaggtactcccgcagactt |
38839191 |
T |
|
| Q |
311 |
gatcctaagatatagatgtatgatacacttagcctttatgatgcttttg |
359 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38839192 |
gatcccaagatatagatgtatgatacacttagcctttatgatgcttttg |
38839240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 132 - 187
Target Start/End: Complemental strand, 4860097 - 4860042
Alignment:
| Q |
132 |
tatttcaaatacattatctcacttatttaatggagggactgggttacacatgagag |
187 |
Q |
| |
|
|||| |||| |||||||||||| |||||||||||||| |||| ||||||||||||| |
|
|
| T |
4860097 |
tattacaaacacattatctcacatatttaatggagggtctggattacacatgagag |
4860042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 132 - 187
Target Start/End: Complemental strand, 4880105 - 4880050
Alignment:
| Q |
132 |
tatttcaaatacattatctcacttatttaatggagggactgggttacacatgagag |
187 |
Q |
| |
|
|||| |||| |||||||||||| |||||||||||||| |||| ||||||||||||| |
|
|
| T |
4880105 |
tattacaaacacattatctcacatatttaatggagggtctggattacacatgagag |
4880050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University