View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10942_low_18 (Length: 347)
Name: NF10942_low_18
Description: NF10942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10942_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 15 - 328
Target Start/End: Original strand, 4246698 - 4246988
Alignment:
| Q |
15 |
ggcctgagtttcatcaaattggtgatcatataaatattttatgttaatatggataaaattaaatagcatgtaatttctgttcacttggtttggtaagact |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4246698 |
ggcctgagtttcatcaaattggtgatcatataaatattt-atgttaatatggataaaatta----------------------cttggtttggtaagact |
4246774 |
T |
 |
| Q |
115 |
catcgaatgtatttatgattannnnnnncacccacactagctaagcaaatgataaaatcaatttgaaagatatgtattaaaaaggataggtaatgtctat |
214 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4246775 |
tatcgaatgtatttatgattatttttttcacccacactagctaagcaaatgataagatcaatttgaaagatatgtattaaaaaggataggtaatgtctat |
4246874 |
T |
 |
| Q |
215 |
taaagtctggtcacatgtctaagtgaaataacgaaaccagagtaattttttacaaaatagtgtggttttgcttcagcattttgaactatccttttgagga |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4246875 |
taaagtctggtcacatgtctaagtgaaataatgaaaccagagtaattttttacaagatagtgtggttttgcttcagcattttgaactatccttttgagga |
4246974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University