View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10942_low_29 (Length: 241)

Name: NF10942_low_29
Description: NF10942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10942_low_29
NF10942_low_29
[»] chr3 (1 HSPs)
chr3 (1-238)||(36222370-36222607)


Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 36222607 - 36222370
Alignment:
1 tgaccctcttggtgctatcttggtaggttcttcagttcatatacacattcaacttttttcaccatnnnnnnnntggcatatcttagtttagttgctttta 100  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||    
36222607 tgaccctcttggggctatcttggtaggttcttcagttcatatacacattcaacttttttcaccataaaaaaaatggcatatcttagtttagttgctttta 36222508  T
101 tttcttcccacttcacaactaatactgcaaagacaaaattaaatcaagttcatcatatttcagcaacatagtcatagtaggtttttgatgtttgaattgg 200  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36222507 tttcttcctacttcacaactaatactgcaaagacaaaattaaatcaagttcatcatatttcagcaacatagtcatagtaggtttttgatgtttgaattgg 36222408  T
201 ttctcggaatttcaaatgtcattcaaaatgagctctct 238  Q
    ||||||||||||||||||||||||||||||||||||||    
36222407 ttctcggaatttcaaatgtcattcaaaatgagctctct 36222370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University