View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10942_low_29 (Length: 241)
Name: NF10942_low_29
Description: NF10942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10942_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 36222607 - 36222370
Alignment:
| Q |
1 |
tgaccctcttggtgctatcttggtaggttcttcagttcatatacacattcaacttttttcaccatnnnnnnnntggcatatcttagtttagttgctttta |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36222607 |
tgaccctcttggggctatcttggtaggttcttcagttcatatacacattcaacttttttcaccataaaaaaaatggcatatcttagtttagttgctttta |
36222508 |
T |
 |
| Q |
101 |
tttcttcccacttcacaactaatactgcaaagacaaaattaaatcaagttcatcatatttcagcaacatagtcatagtaggtttttgatgtttgaattgg |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36222507 |
tttcttcctacttcacaactaatactgcaaagacaaaattaaatcaagttcatcatatttcagcaacatagtcatagtaggtttttgatgtttgaattgg |
36222408 |
T |
 |
| Q |
201 |
ttctcggaatttcaaatgtcattcaaaatgagctctct |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36222407 |
ttctcggaatttcaaatgtcattcaaaatgagctctct |
36222370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University