View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10942_low_32 (Length: 224)
Name: NF10942_low_32
Description: NF10942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10942_low_32 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 29 - 210
Target Start/End: Complemental strand, 1330296 - 1330115
Alignment:
| Q |
29 |
tacttcggttctcaataaaatatttggtatgttttttcttatatgatttcaaggagttggtgtttctcctaataaagagaattttgttgaagtttatgag |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1330296 |
tacttcggttctcaataaaatatttggtatgttttttcttatatgatttcaaggagttggtgtttctcctaataaagagaattttgttgaagtttatgag |
1330197 |
T |
|
| Q |
129 |
gatgaaaataatggggttattagctacgggttaagatggtggaaaaattggcaaagaaattcatggttgttatcttctctgc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1330196 |
gatgaaaataatggggttattagctacgggttaagatggtggaaaaattggcaaagaaattcatggttgttatcttctctgc |
1330115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University