View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10943_high_1 (Length: 473)
Name: NF10943_high_1
Description: NF10943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10943_high_1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 3e-86; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 3e-86
Query Start/End: Original strand, 13 - 235
Target Start/End: Complemental strand, 41953606 - 41953386
Alignment:
| Q |
13 |
gaaagcgatgaagattctgacaaggagacaccgaagaaggtaactggagactatattgtgcttcgatttgtctccgaatttgaatttaa-tatgagtttt |
111 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | |||||||| |
|
|
| T |
41953606 |
gaaagcgatgaagattctgatgaggagacaccgaagaaggtaactggagactatattgtgcttcgatttgtctctgaatttgaatttaattttgagtttt |
41953507 |
T |
|
| Q |
112 |
gttttagactgaagggagcaacaagaggagggatgctgaatcttccaaggaaacacatgtacttgtgaaaaaggcaaaatttgttactccagagaagact |
211 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||||||||||||||||||| ||||| |||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
41953506 |
gttttagactgaagggagcaacaa---gagggttgctgaatcttccaaggaaacacctgtacctgtgaagaaggcaaaatttgtcactccagagaagact |
41953410 |
T |
|
| Q |
212 |
ggttagttctttcccctgtacttt |
235 |
Q |
| |
|
|||||||| ||||||||||||||| |
|
|
| T |
41953409 |
ggttagttttttcccctgtacttt |
41953386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 347 - 456
Target Start/End: Complemental strand, 41952822 - 41952713
Alignment:
| Q |
347 |
ccttaccctaagcaggctggtaaatctgctgcaaataacaagcagccagagaagcaggagactccaaagtctagtggagattacagctgcaagccctgta |
446 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41952822 |
ccttaccctaagcaggctggtaaatctgctgcaaataacaagcagccagagaagcaggagactccaaagtctagtggagattacagctgcaagccctgta |
41952723 |
T |
|
| Q |
447 |
acaggtgatt |
456 |
Q |
| |
|
|||||||||| |
|
|
| T |
41952722 |
acaggtgatt |
41952713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University