View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10943_high_4 (Length: 328)

Name: NF10943_high_4
Description: NF10943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10943_high_4
NF10943_high_4
[»] chr3 (2 HSPs)
chr3 (159-326)||(32790349-32790516)
chr3 (3-94)||(32790584-32790669)
[»] chr7 (2 HSPs)
chr7 (219-288)||(48283665-48283734)
chr7 (162-217)||(48284253-48284308)


Alignment Details
Target: chr3 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 159 - 326
Target Start/End: Complemental strand, 32790516 - 32790349
Alignment:
159 atacaatcctagatgcgtcaaattcgagctgaaattgatgctgtatccaaagctaatggcgatcgcatgaggaaaccgaagggcgacaggttatttctta 258  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32790516 atacaatcctagatgcgtcaaattcgagctgaaattggtgctgtatccaaagctaatggcgatcgcatgaggaaaccgaagggcgacaggttatttctta 32790417  T
259 tttacctgtttaattttccagtctttttgcacgatgttgatatacatacaagtgttcatctcactcga 326  Q
    ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||    
32790416 tttgcctgtttaattttccagtctttttgcacgatgttgatatacatacaagtgttcatgtcagtcga 32790349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 3 - 94
Target Start/End: Complemental strand, 32790669 - 32790584
Alignment:
3 tttgaatttgaaaaccaaaaaatggaatacgtgagcccagaaggacttcgcttggatggtcgcagtcgcagacccatggaagtaggtactac 94  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||      |||||||||||||||||||||||||    
32790669 tttgaatttgaacaccaaaaaatggaatacgtgagcccagaaggacttcgcttggatggtc------gcagacccatggaagtaggtactac 32790584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 219 - 288
Target Start/End: Complemental strand, 48283734 - 48283665
Alignment:
219 gatcgcatgaggaaaccgaagggcgacaggttatttcttatttacctgtttaattttccagtctttttgc 288  Q
    ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| |||||||||||||    
48283734 gatcgcatgaggaaaccaaagggcgacaggttatttcttatttacttgtttaatttcccagtctttttgc 48283665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 48284308 - 48284253
Alignment:
162 caatcctagatgcgtcaaattcgagctgaaattgatgctgtatccaaagctaatgg 217  Q
    |||||||||||||| ||||||||||| || |||| |||||||||||||||| ||||    
48284308 caatcctagatgcgacaaattcgagcagagattggtgctgtatccaaagctgatgg 48284253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University