View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10943_high_8 (Length: 249)
Name: NF10943_high_8
Description: NF10943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10943_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 9 - 245
Target Start/End: Original strand, 44281661 - 44281898
Alignment:
| Q |
9 |
ggtactaaatctgttaattttttctatt-attgtgcagactatgttcaaaactcttgcgatagcattttcaacaatgacgcttttcactggaatcacgcc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44281661 |
ggtactaaatctgttaattttttctatttattgtgcagactatgttcaaaactcttgcgatagcattttcaacaatgacgcttttcactggaatcacgcc |
44281760 |
T |
 |
| Q |
108 |
tctgtatggttctagccttctgtatgcaggccctgcaagtcttgtttggggatgggttgttgtttgtttcttcacttggtttgttgggattgcaatggcg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44281761 |
tctgtatggttctagccttctgtatgcaggccctgcaagtcttgtttggggatgggttgttgtttgtttcttcacttggtttgttgggattgcaatggcg |
44281860 |
T |
 |
| Q |
208 |
gaaatatgttcatcttttccggtttgtctctgctcctc |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44281861 |
gaaatatgttcatcttttccggtttgtctcttctcctc |
44281898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 44 - 95
Target Start/End: Original strand, 41367877 - 41367928
Alignment:
| Q |
44 |
agactatgttcaaaactcttgcgatagcattttcaacaatgacgcttttcac |
95 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
41367877 |
agactatgttcaaaactctcgcgatagcattttcaacaatgacacttttcac |
41367928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 206
Target Start/End: Original strand, 41367993 - 41368025
Alignment:
| Q |
174 |
tttcttcacttggtttgttgggattgcaatggc |
206 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
41367993 |
tttcttcacttagtttgttgggattgcaatggc |
41368025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University