View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10943_low_4 (Length: 328)
Name: NF10943_low_4
Description: NF10943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10943_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 159 - 326
Target Start/End: Complemental strand, 32790516 - 32790349
Alignment:
| Q |
159 |
atacaatcctagatgcgtcaaattcgagctgaaattgatgctgtatccaaagctaatggcgatcgcatgaggaaaccgaagggcgacaggttatttctta |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32790516 |
atacaatcctagatgcgtcaaattcgagctgaaattggtgctgtatccaaagctaatggcgatcgcatgaggaaaccgaagggcgacaggttatttctta |
32790417 |
T |
|
| Q |
259 |
tttacctgtttaattttccagtctttttgcacgatgttgatatacatacaagtgttcatctcactcga |
326 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
32790416 |
tttgcctgtttaattttccagtctttttgcacgatgttgatatacatacaagtgttcatgtcagtcga |
32790349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 3 - 94
Target Start/End: Complemental strand, 32790669 - 32790584
Alignment:
| Q |
3 |
tttgaatttgaaaaccaaaaaatggaatacgtgagcccagaaggacttcgcttggatggtcgcagtcgcagacccatggaagtaggtactac |
94 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32790669 |
tttgaatttgaacaccaaaaaatggaatacgtgagcccagaaggacttcgcttggatggtc------gcagacccatggaagtaggtactac |
32790584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 219 - 288
Target Start/End: Complemental strand, 48283734 - 48283665
Alignment:
| Q |
219 |
gatcgcatgaggaaaccgaagggcgacaggttatttcttatttacctgtttaattttccagtctttttgc |
288 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
48283734 |
gatcgcatgaggaaaccaaagggcgacaggttatttcttatttacttgtttaatttcccagtctttttgc |
48283665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 48284308 - 48284253
Alignment:
| Q |
162 |
caatcctagatgcgtcaaattcgagctgaaattgatgctgtatccaaagctaatgg |
217 |
Q |
| |
|
|||||||||||||| ||||||||||| || |||| |||||||||||||||| |||| |
|
|
| T |
48284308 |
caatcctagatgcgacaaattcgagcagagattggtgctgtatccaaagctgatgg |
48284253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University