View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10944_low_7 (Length: 232)
Name: NF10944_low_7
Description: NF10944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10944_low_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 18 - 217
Target Start/End: Complemental strand, 29093156 - 29092958
Alignment:
| Q |
18 |
tctaaatgtacctacatgcaaggctggcgatggtggcagcgacagaaataggcagtggtttcatgtatttttacatttgtttacactagttcatccttat |
117 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
29093156 |
tctaaaagtacctacgtgcaaggctggcgatggtggcagcgacagaaataggcagtggtttcatgtatttttacatttgtttacactagt-cttccttat |
29093058 |
T |
 |
| Q |
118 |
aggttcatgatccgtaaccgtgatttgacatggctcttttggttcattttgagttgcatcttacttgtagcaaggaattaaattactgtgctgtatctct |
217 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29093057 |
aggttcatgatccgtaaccatgatttgacatggctcttttggttcattttgagttgtatcttacttggagcaaggaattaaattactgtgctgtatctct |
29092958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 132 - 204
Target Start/End: Complemental strand, 43286977 - 43286905
Alignment:
| Q |
132 |
taaccgtgatttgacatggctcttttggttcattttgagttgcatcttacttgtagcaaggaattaaattact |
204 |
Q |
| |
|
||||| ||||||||||| |||| ||||||||||||||| |||||||||| ||| |||| || |||||| |||| |
|
|
| T |
43286977 |
taaccatgatttgacattgctcctttggttcattttgatttgcatcttatttggagcatgggattaaaatact |
43286905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University