View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10946_low_5 (Length: 217)
Name: NF10946_low_5
Description: NF10946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10946_low_5 |
 |  |
|
| [»] scaffold0076 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 7e-82; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 17 - 197
Target Start/End: Complemental strand, 35991718 - 35991540
Alignment:
| Q |
17 |
caaaggcacaagatgaattccactttatttgtaagaattactagttgctcaacgtaggatgtacttggaatatcccttggcttattatgcatatgtgtgc |
116 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35991718 |
caaaggcacaagatgga--ccactttatttgtaagaattactagttgctcaacgtaggatgtgcttggaatatcccttggcttattatgcatatgtgtgc |
35991621 |
T |
 |
| Q |
117 |
atgcatgtctgtgtaagtttttagttatcatcacatcaccaaaaaatattatatatacacatatgggcacccagaaattgt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35991620 |
atgcatgtctgtgtaagtttttagttataatcacatcaccaaaaaatattatatatacacatatggacacccagaaattgt |
35991540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 44 - 179
Target Start/End: Complemental strand, 35980933 - 35980799
Alignment:
| Q |
44 |
tttgtaagaattactagttgctcaacgtaggatgtacttggaatatcccttggcttattatg-catatgtg-tgcatgcatgtctgtgtaagtttttagt |
141 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |||| || || ||||||||||||||| ||||||| | |
|
|
| T |
35980933 |
tttgtaagaattactagttgctcaacataggatgtacttggaatatcctttggcttaatatgtgctagttgctgcatgcatgtctgt----gtttttatt |
35980838 |
T |
 |
| Q |
142 |
tatc-atcacatcaccaaaaaatattatatatacacata |
179 |
Q |
| |
|
|||| ||||||||||||| ||||| |||| ||||||||| |
|
|
| T |
35980837 |
tatcaatcacatcaccaacaaatactataaatacacata |
35980799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 104 - 173
Target Start/End: Complemental strand, 12325434 - 12325365
Alignment:
| Q |
104 |
tgcatatgtgtgcatgcatgtctgtgtaagtttttagttatcat-cacatcaccaaaaaatattatatata |
173 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| ||||||||||| || || ||||||||||||||| |||| |
|
|
| T |
12325434 |
tgcatatgtgtgcatgc-tgtctatgtaagttgttagttatcatccatattaccaaaaaatattatctata |
12325365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0076 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0076
Description:
Target: scaffold0076; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 91 - 173
Target Start/End: Complemental strand, 47625 - 47543
Alignment:
| Q |
91 |
ccttggcttattatgcatatgtgtgcatgcatgtctgtgtaagtttttagttatcat-cacatcaccaaaaaatattatatata |
173 |
Q |
| |
|
|||| |||| || ||||||||||||||||| ||||| |||||||| ||||||||||| || || | ||||||||||||| |||| |
|
|
| T |
47625 |
ccttagcttcttctgcatatgtgtgcatgc-tgtctatgtaagttgttagttatcatccatattatcaaaaaatattatctata |
47543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University