View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10947_high_11 (Length: 241)
Name: NF10947_high_11
Description: NF10947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10947_high_11 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 18 - 241
Target Start/End: Original strand, 50472454 - 50472677
Alignment:
| Q |
18 |
agatcttagaataccgacaaatgaaatctccaaaatgataacatgatattaagatagtaacaaaatctacggatttgtctcatctaagaatccatcctat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
50472454 |
agatcttagaataccgacaaatgaaatctccaaaatgataacatgatattaagatagtaacacaatctacggatttgtctcatctaagaatccatgctat |
50472553 |
T |
 |
| Q |
118 |
tgtttcctttggattgggttctaatcccattaacatttctcttttaaaatagttgagattgcgggttgcaatgtcagtgggcaattacgcatgttttcca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50472554 |
tgtttcctttggattgggttctaatcccattaacatttctcttttaaaatagttgagattgcgggttgcaatgtcagtgggcaattacgcatgttttcca |
50472653 |
T |
 |
| Q |
218 |
ctttaaatgatgcagttgtacttt |
241 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
50472654 |
ctttaaatgatgcagttgtacttt |
50472677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University