View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10947_high_16 (Length: 217)
Name: NF10947_high_16
Description: NF10947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10947_high_16 |
 |  |
|
| [»] scaffold0019 (1 HSPs) |
 |  |  |
|
| [»] scaffold0187 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 67 - 199
Target Start/End: Complemental strand, 11997235 - 11997103
Alignment:
| Q |
67 |
atatttatacttttgccattgaacgtggattctaataaacctttgaatagtaagtttgtaaatatctccttcggatggccaataccatatatcaatccca |
166 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
11997235 |
atatttatacttttgtcattgaacgttgattctaataaacctttgaatagtaagtttgtacatatctcctttggatggccaataccatatatcaatccca |
11997136 |
T |
 |
| Q |
167 |
aattaattattaattgttttatatagtttgaaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
11997135 |
aattaattattaattgttttatatagtttgaaa |
11997103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0019 (Bit Score: 67; Significance: 6e-30; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 62 - 188
Target Start/End: Original strand, 105949 - 106075
Alignment:
| Q |
62 |
aaaacatatttatacttttgccattgaacgtggattctaataaacctttgaatagtaagtttgtaaatatctccttcggatggccaataccatatatcaa |
161 |
Q |
| |
|
|||||||||||||||| ||| | ||||| || |||||| ||||||||||||||| |||| |||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
105949 |
aaaacatatttatactattgtcgttgaatgttgattctgataaacctttgaataataagattgtaaatatctcctttggatggccaatgccatatatcaa |
106048 |
T |
 |
| Q |
162 |
tcccaaattaattattaattgttttat |
188 |
Q |
| |
|
| ||||||| ||| |||| | |||||| |
|
|
| T |
106049 |
ttccaaattgatttttaactattttat |
106075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187 (Bit Score: 33; Significance: 0.000000001; HSPs: 3)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 14 - 62
Target Start/End: Complemental strand, 27368 - 27320
Alignment:
| Q |
14 |
gatgaaaacagaggcagttgaggtgtagctgatcctgtcattgacatga |
62 |
Q |
| |
|
|||||| ||||||| ||||| ||||||||||||||||| |||||||||| |
|
|
| T |
27368 |
gatgaagacagaggtagttggggtgtagctgatcctgttattgacatga |
27320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 14 - 62
Target Start/End: Complemental strand, 6712 - 6664
Alignment:
| Q |
14 |
gatgaaaacagaggcagttgaggtgtagctgatcctgtcattgacatga |
62 |
Q |
| |
|
|||||| | ||||| ||||| ||||||||||||||||| |||||||||| |
|
|
| T |
6712 |
gatgaagatagaggaagttggggtgtagctgatcctgttattgacatga |
6664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 14 - 62
Target Start/End: Complemental strand, 17040 - 16992
Alignment:
| Q |
14 |
gatgaaaacagaggcagttgaggtgtagctgatcctgtcattgacatga |
62 |
Q |
| |
|
|||||| | ||||| ||||| ||||||||||||||||| |||||||||| |
|
|
| T |
17040 |
gatgaagatagaggaagttggggtgtagctgatcctgttattgacatga |
16992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 14 - 62
Target Start/End: Original strand, 37855536 - 37855584
Alignment:
| Q |
14 |
gatgaaaacagaggcagttgaggtgtagctgatcctgtcattgacatga |
62 |
Q |
| |
|
|||||| ||||||| ||||| ||||||||||||||||| |||||||||| |
|
|
| T |
37855536 |
gatgaagacagaggtagttggggtgtagctgatcctgttattgacatga |
37855584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 14 - 62
Target Start/End: Original strand, 37867724 - 37867772
Alignment:
| Q |
14 |
gatgaaaacagaggcagttgaggtgtagctgatcctgtcattgacatga |
62 |
Q |
| |
|
|||||| ||||||| ||||| ||||||||||||||||| |||||||||| |
|
|
| T |
37867724 |
gatgaagacagaggtagttggggtgtagctgatcctgttattgacatga |
37867772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 14 - 62
Target Start/End: Original strand, 37881764 - 37881812
Alignment:
| Q |
14 |
gatgaaaacagaggcagttgaggtgtagctgatcctgtcattgacatga |
62 |
Q |
| |
|
|||||| ||||||| ||||| ||||||||||||||||| |||||||||| |
|
|
| T |
37881764 |
gatgaagacagaggtagttggggtgtagctgatcctgttattgacatga |
37881812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 14 - 62
Target Start/End: Original strand, 37911709 - 37911757
Alignment:
| Q |
14 |
gatgaaaacagaggcagttgaggtgtagctgatcctgtcattgacatga |
62 |
Q |
| |
|
|||||| ||||||| ||||| ||||||||||||||||| |||||||||| |
|
|
| T |
37911709 |
gatgaagacagaggtagttggggtgtagctgatcctgttattgacatga |
37911757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University