View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10947_low_18 (Length: 202)

Name: NF10947_low_18
Description: NF10947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10947_low_18
NF10947_low_18
[»] chr7 (2 HSPs)
chr7 (13-88)||(42064779-42064854)
chr7 (145-177)||(42064690-42064722)


Alignment Details
Target: chr7 (Bit Score: 76; Significance: 2e-35; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 13 - 88
Target Start/End: Complemental strand, 42064854 - 42064779
Alignment:
13 aagaatagggaaaaagtacagctaattactaaattaatggaggttagtctcaaattatcctcctagtgtgtagttc 88  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42064854 aagaatagggaaaaagtacagctaattactaaattaatggaggttagtctcaaattatcctcctagtgtgtagttc 42064779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 145 - 177
Target Start/End: Complemental strand, 42064722 - 42064690
Alignment:
145 ttgtcatttctttagttaattgtgaaatgattt 177  Q
    |||||||||||||||||||||||||||||||||    
42064722 ttgtcatttctttagttaattgtgaaatgattt 42064690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University