View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10947_low_18 (Length: 202)
Name: NF10947_low_18
Description: NF10947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10947_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 76; Significance: 2e-35; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 13 - 88
Target Start/End: Complemental strand, 42064854 - 42064779
Alignment:
| Q |
13 |
aagaatagggaaaaagtacagctaattactaaattaatggaggttagtctcaaattatcctcctagtgtgtagttc |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42064854 |
aagaatagggaaaaagtacagctaattactaaattaatggaggttagtctcaaattatcctcctagtgtgtagttc |
42064779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 145 - 177
Target Start/End: Complemental strand, 42064722 - 42064690
Alignment:
| Q |
145 |
ttgtcatttctttagttaattgtgaaatgattt |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42064722 |
ttgtcatttctttagttaattgtgaaatgattt |
42064690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University