View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10947_low_7 (Length: 268)
Name: NF10947_low_7
Description: NF10947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10947_low_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 119; Significance: 7e-61; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 1 - 148
Target Start/End: Complemental strand, 2348052 - 2347905
Alignment:
| Q |
1 |
gattgatggctcaaaccagagggagaagagaggnnnnnnngattgataactgagacacctttttgatgtaccgaatgatatttgctatttggaaaaaccg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2348052 |
gattgatggctcaaaccagagggagaagagaggaaaaaaagattgataactcagacacctttttgatgtaccgaatgatatttgctatttggaaaaaccg |
2347953 |
T |
|
| Q |
101 |
gagtgaaacttggtgagcaagtagggcacgcgcgaaaaagataacaag |
148 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2347952 |
gagtgaaacttggtgagcaagtagggtacgcgcgaaaaagataacaag |
2347905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 227 - 268
Target Start/End: Complemental strand, 2347826 - 2347785
Alignment:
| Q |
227 |
gcagctgtctcatttgcagctccttagcctggttctcataaa |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2347826 |
gcagctgtctcatttgcagctccttagcctggttctcgtaaa |
2347785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 3 - 81
Target Start/End: Complemental strand, 2348426 - 2348349
Alignment:
| Q |
3 |
ttgatggctcaaaccagagggagaagagaggnnnnnnngattgataactgagacacctttttgatgtaccgaatgatat |
81 |
Q |
| |
|
|||||||||||||| |||||||||||||| | ||||||||||| |||| |||||||| ||||||||||||||| |
|
|
| T |
2348426 |
ttgatggctcaaactagagggagaagagaagaaaaaa-gattgataactcagacgcctttttggtgtaccgaatgatat |
2348349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University