View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10948_low_7 (Length: 209)

Name: NF10948_low_7
Description: NF10948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10948_low_7
NF10948_low_7
[»] chr7 (2 HSPs)
chr7 (83-187)||(48595331-48595435)
chr7 (26-59)||(48595274-48595307)


Alignment Details
Target: chr7 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 83 - 187
Target Start/End: Original strand, 48595331 - 48595435
Alignment:
83 caatttcatgatctccatgcatatctatctatctatctagctagctagctacttgcaaataattaattaaactattattattattattaggattttgatc 182  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48595331 caatttcatgatctccatgcatatctatctatctatctagctagctagctacttgcaaataattaattaaactattattattattattaggattttgatc 48595430  T
183 accaa 187  Q
    |||||    
48595431 accaa 48595435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 26 - 59
Target Start/End: Original strand, 48595274 - 48595307
Alignment:
26 agcagcagcagcagtaagtagcatagtaccccca 59  Q
    ||||||||||||||||||||||||||||||||||    
48595274 agcagcagcagcagtaagtagcatagtaccccca 48595307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University