View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10948_low_7 (Length: 209)
Name: NF10948_low_7
Description: NF10948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10948_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 83 - 187
Target Start/End: Original strand, 48595331 - 48595435
Alignment:
| Q |
83 |
caatttcatgatctccatgcatatctatctatctatctagctagctagctacttgcaaataattaattaaactattattattattattaggattttgatc |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48595331 |
caatttcatgatctccatgcatatctatctatctatctagctagctagctacttgcaaataattaattaaactattattattattattaggattttgatc |
48595430 |
T |
 |
| Q |
183 |
accaa |
187 |
Q |
| |
|
||||| |
|
|
| T |
48595431 |
accaa |
48595435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 26 - 59
Target Start/End: Original strand, 48595274 - 48595307
Alignment:
| Q |
26 |
agcagcagcagcagtaagtagcatagtaccccca |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
48595274 |
agcagcagcagcagtaagtagcatagtaccccca |
48595307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University