View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10949_high_16 (Length: 296)
Name: NF10949_high_16
Description: NF10949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10949_high_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 122 - 168
Target Start/End: Complemental strand, 12029921 - 12029875
Alignment:
| Q |
122 |
accttaaggttctagataagattccaatgtcctgctcatcttagccc |
168 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12029921 |
accttaaggttctagatgagattccaatgtcctgctcatcttagccc |
12029875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University