View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10949_high_16 (Length: 296)

Name: NF10949_high_16
Description: NF10949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10949_high_16
NF10949_high_16
[»] chr8 (1 HSPs)
chr8 (122-168)||(12029875-12029921)


Alignment Details
Target: chr8 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 122 - 168
Target Start/End: Complemental strand, 12029921 - 12029875
Alignment:
122 accttaaggttctagataagattccaatgtcctgctcatcttagccc 168  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||    
12029921 accttaaggttctagatgagattccaatgtcctgctcatcttagccc 12029875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University