View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10949_low_18 (Length: 253)
Name: NF10949_low_18
Description: NF10949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10949_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 145
Target Start/End: Complemental strand, 34701217 - 34701073
Alignment:
| Q |
1 |
tcactatagcttaattattctcacgggttctttcctgatttgtcctatttacttagatttcatcccaatctagccagcaaacaaaattttgtatatatcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34701217 |
tcactatagcttaattattctcacgggttctttcctgatttgtcctatttacttagatttcatcccaatctagccagcaaacaaaattttgtatatatcc |
34701118 |
T |
 |
| Q |
101 |
agttgctgtttcacatttgattgcacatgctgaatttgcggtgac |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34701117 |
agttgctgtttcacatttgattgcacatgctgaatttgcggtgac |
34701073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 205 - 238
Target Start/End: Complemental strand, 34701043 - 34701010
Alignment:
| Q |
205 |
gttttggaggtattgtctgtttttatctataaat |
238 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
34701043 |
gttttgaaggtattgtctgtttttatctataaat |
34701010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University