View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10949_low_21 (Length: 237)

Name: NF10949_low_21
Description: NF10949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10949_low_21
NF10949_low_21
[»] chr7 (1 HSPs)
chr7 (79-220)||(32224267-32224408)


Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 79 - 220
Target Start/End: Original strand, 32224267 - 32224408
Alignment:
79 agttgtggttcagaaaaccgaggcgtgtggtttcatggcaggtgttgaagatgagctagggtttgtcaacgtgaaaggagacaacaacaacgggtcgggt 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32224267 agttgtggttcagaaaaccgaggcgtgtggtttcatggcaggtgttgaagatgagctagggtttgtcaacgtgaaaggagacaacaacaacgggtcgggt 32224366  T
179 caacggatccatcatgatcatggttttgttgctgctgcattt 220  Q
    ||||||||||||||||||||||||||||||||||||||||||    
32224367 caacggatccatcatgatcatggttttgttgctgctgcattt 32224408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University