View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1094_high_8 (Length: 255)
Name: NF1094_high_8
Description: NF1094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1094_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 47 - 243
Target Start/End: Complemental strand, 33127337 - 33127141
Alignment:
| Q |
47 |
cttagactcctttatgcatgtctttggtgtggaacatggttcaaagtttatgcttgtaatccaaacttacttattgatatatgtagttttggtggtttag |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33127337 |
cttagactcctttatgcatgtctttggtgtggaacatggttcaaaatttatgcttgtaatccaaacttgcttattgatatatgtagttttggtggtttag |
33127238 |
T |
|
| Q |
147 |
ctcttttcaggaacaaccaatggaggtgaaagtgtttatacacaccatgctttcccctcaaaaagaaactaccaccactttaccttaattcaatatt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33127237 |
ctcttttcaggaacaaccaatggaggtgaaagtgtttatacacaccatgctttcccctcaaaaagaaactaccaccactttaccttaattcaatatt |
33127141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 33127384 - 33127355
Alignment:
| Q |
1 |
gttaacctaaattaaataattaaattgaac |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
33127384 |
gttaacctaaattaaataattaaattgaac |
33127355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University