View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1094_low_14 (Length: 251)
Name: NF1094_low_14
Description: NF1094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1094_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 39003658 - 39003877
Alignment:
| Q |
1 |
ctcacttatatgattattcaaagctttcttcaaaaaagaaaatgattgttcgaagctcgatatcccaacaaaagagaacaannnnnnnnnacacaaacct |
100 |
Q |
| |
|
||||||||||||||| ||| |||||| ||| |||||| |||||||||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
39003658 |
ctcacttatatgattgttcgaagcttcctttaaaaaa--aaatgattgttcgaagctcgatgtcccaacaaaagagaacaatttttttttacacaaacct |
39003755 |
T |
 |
| Q |
101 |
aaatacaaattttatattttacgtttttgataggatatttaaaataagtagcacttatgtggttaattagctagttctcgaaacaatatgactcacttta |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39003756 |
aaatacaaattttatattatacgtttttgataggatatttaaaataagtagcacttatgtggttaattagctagttctcgaaacaatatgactcacttta |
39003855 |
T |
 |
| Q |
201 |
aaccaaaagaatataacgtagg |
222 |
Q |
| |
|
|||||||||||||||| ||||| |
|
|
| T |
39003856 |
aaccaaaagaatataatgtagg |
39003877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University