View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1094_low_15 (Length: 251)
Name: NF1094_low_15
Description: NF1094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1094_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 6 - 244
Target Start/End: Complemental strand, 39003448 - 39003214
Alignment:
| Q |
6 |
ggaaaattaagatcataattggttttcttgagaaaattataatatttattttttgaa-attagannnnnnnnnnnnnagaaaattaagattttatataca |
104 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
39003448 |
ggaaaattgagatcataattggttttcttgagaaaattataatatttattttttgaagattagatttttttt-----agaaaattaagattttatataca |
39003354 |
T |
 |
| Q |
105 |
catatataagtggnnnnnnnaatctatatacaataatacaaacatctcaaatagaagaagttctaaagtggaggaagtatatgggactcaaattccctgt |
204 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39003353 |
catatataagtggtttttttaatctatatacaataatacaaacatctcaaatagaagaagttctaaagtggaggaagtatatgggactcagattccctgt |
39003254 |
T |
 |
| Q |
205 |
tgtaaaaaagcacgctgttttgccggtgtttttcatctca |
244 |
Q |
| |
|
|||||||||| | ||||||| ||| | |||||||||||| |
|
|
| T |
39003253 |
tgtaaaaaagtattctgttttaccgctatttttcatctca |
39003214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 244
Target Start/End: Original strand, 54425633 - 54425691
Alignment:
| Q |
186 |
tgggactcaaattccctgttgtaaaaaagcacgctgttttgccggtgtttttcatctca |
244 |
Q |
| |
|
||||||| | ||||||||||||||||||||||| |||||| ||| ||||| ||||||| |
|
|
| T |
54425633 |
tgggactgagattccctgttgtaaaaaagcacgatgttttaccgtagttttgcatctca |
54425691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University