View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1094_low_17 (Length: 203)
Name: NF1094_low_17
Description: NF1094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1094_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 7e-51; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 7e-51
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 20338107 - 20338002
Alignment:
| Q |
1 |
tgaattttggtgacgtgatggtaggacgctgtgatggtgataggagactcatgatgggatttttgttgcaaatgtttggagaattggagagtagaaaggt |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20338107 |
tgaatttcggtgacgtgatggtaggacgctgtgatggtgataggagactcatgatgggatttttgttgcaaatgtttggagaattggagagtagaaaggt |
20338008 |
T |
|
| Q |
101 |
tgaaag |
106 |
Q |
| |
|
|||||| |
|
|
| T |
20338007 |
tgaaag |
20338002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 20141708 - 20141782
Alignment:
| Q |
1 |
tgaattttggtgacgtgatggtaggacgctgtgatggtgataggagactcatgatgggatttttgttgcaaatgt |
75 |
Q |
| |
|
|||||||||||| | |||||||||||||| |||||||||||||| || ||||||||||||||||||| ||||||| |
|
|
| T |
20141708 |
tgaattttggtggcatgatggtaggacgccgtgatggtgataggtgattcatgatgggatttttgttacaaatgt |
20141782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 67
Target Start/End: Original strand, 20134206 - 20134272
Alignment:
| Q |
1 |
tgaattttggtgacgtgatggtaggacgctgtgatggtgataggagactcatgatgggatttttgtt |
67 |
Q |
| |
|
|||||||||||||| || |||||||||| |||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
20134206 |
tgaattttggtgacatgttggtaggacgttgtgatggagataggagattcatgatgggatttttgtt |
20134272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 20127028 - 20127103
Alignment:
| Q |
1 |
tgaattttggtgacgtgatggtaggacgctgtgatggtgataggagactcatgatgggatttttgttgcaaatgtt |
76 |
Q |
| |
|
||||||||||||||||| |||||| | | |||||||| || || || |||| |||||||||||||| |||||||| |
|
|
| T |
20127028 |
tgaattttggtgacgtggtggtagaatgttgtgatggagaaagaggattcattatgggatttttgttacaaatgtt |
20127103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University