View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1094_low_6 (Length: 303)
Name: NF1094_low_6
Description: NF1094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1094_low_6 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 73 - 303
Target Start/End: Original strand, 53699858 - 53700089
Alignment:
| Q |
73 |
tcctttgcagaagaaagctagctccttctgtggggtgtggcagtggtataccaaaattcccactatgatactaccagtaataacaaacaattattctgct |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
53699858 |
tcctttgcagaagaaagctagctccttctgtgggttgtggcagtggtataccaaaattcccactatgatactaccaataataacaaacaattattctgct |
53699957 |
T |
 |
| Q |
173 |
aattgttgaacatgattcagggagacacactatcgacatacattaaacttacaataccgtcatccttaccccaccac-tttgatgcttcaaagaatatca |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
53699958 |
aattgttgaacatgattcagggagacacactatcgacatacattaaacttacaataccgtcatccttaccccaccacttttgatgcttcaaagaatatca |
53700057 |
T |
 |
| Q |
272 |
tcaactccaaaaacaagaatatattttaacat |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
53700058 |
tcaactccaaaaacaagaatatattttaacat |
53700089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University