View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10950_high_15 (Length: 333)
Name: NF10950_high_15
Description: NF10950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10950_high_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 17 - 325
Target Start/End: Complemental strand, 31235131 - 31234823
Alignment:
| Q |
17 |
cagatattaattgctattgcagaaacttacttttatttcaaaacttaatccagcttgaattatacttgtatgaattttatcattgggacaatgtaatgga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31235131 |
cagatattaattgctattgcagaaacttacttttatttcaaaacttaatccagcttgaattatacttgtatgaattttatcattgggacaatgtaatgga |
31235032 |
T |
 |
| Q |
117 |
agtgcttcaaaattgccacaagcttcaagatattactattgaacaggttacttatgtttgtggaatgnnnnnnnnaggttattttctttgcttatgtttc |
216 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31235031 |
agtgcttcaaaattgccacaatcttcaagatattactattgaacaggttacttatgtttgtggaatgtttcttttaggttattttctttgcttatgtttc |
31234932 |
T |
 |
| Q |
217 |
gtaaatcttattttgccatatgttttgcagtggataaacgacagaagcaaccaagatttgtacaaaaactggaactacctaaatgatgttcctaagtgca |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31234931 |
gtaaatcttattttgccatatgttttgcagtggataaacgacagaagcaaccaagatttgtgcaaaaactggaactacctaaatgatgttcctaagtgca |
31234832 |
T |
 |
| Q |
317 |
tttcttctc |
325 |
Q |
| |
|
||||||||| |
|
|
| T |
31234831 |
tttcttctc |
31234823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University