View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10950_high_28 (Length: 244)
Name: NF10950_high_28
Description: NF10950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10950_high_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 177
Target Start/End: Original strand, 7278898 - 7279074
Alignment:
| Q |
1 |
tcaccgccttcaacttcctctgtgggacccaccatttgaatttgatcaacaaattcttgcagaactatagcccttttgataatcgactttctcaagtccc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7278898 |
tcaccgccttcaacttcctctgtgggacccaccatttgaatttgatcaacaaattcttgaagaacaatagcccttttgataatcgactttctcaagtccc |
7278997 |
T |
 |
| Q |
101 |
taagagcagaacaatggaagactctaacagaatccaacctaagaagcaaattcatgattgtttcagcgatccttatc |
177 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7278998 |
taagagcagaacaatgaaatactctaacagaatccaacctaagaagcaaattcataattgtttcagcgatccttatc |
7279074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 177
Target Start/End: Complemental strand, 7374941 - 7374765
Alignment:
| Q |
1 |
tcaccgccttcaacttcctctgtgggacccaccatttgaatttgatcaacaaattcttgcagaactatagcccttttgataatcgactttctcaagtccc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7374941 |
tcaccgccttcaacttcctctgtgggacccaccatttgaatttgatcaacaaattcttgaagaacaatagcccttttgataatcgactttctcaagtccc |
7374842 |
T |
 |
| Q |
101 |
taagagcagaacaatggaagactctaacagaatccaacctaagaagcaaattcatgattgtttcagcgatccttatc |
177 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7374841 |
taagagcagaacaatgaaatactctaacagaatccaacctaagaagcaaattcataattgtttcagcgatccttatc |
7374765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 125 - 177
Target Start/End: Complemental strand, 5848215 - 5848163
Alignment:
| Q |
125 |
taacagaatccaacctaagaagcaaattcatgattgtttcagcgatccttatc |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| || |||||||||| |
|
|
| T |
5848215 |
taacagaatccaacctaagaagcaaattcatgatggttttagtgatccttatc |
5848163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University