View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10950_high_30 (Length: 239)
Name: NF10950_high_30
Description: NF10950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10950_high_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 20 - 221
Target Start/End: Original strand, 24846930 - 24847131
Alignment:
| Q |
20 |
gccagcgttgaccgtatctttgctcttgtttcctcgctatctagtcttgctggtctctttctcatcatccttaaccgccacaaatctcatgcttatgtga |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24846930 |
gccagcgttgaccgtatctttgctcttgtttcctcgctatctagtcttgttggtctctttctcatcatccttaaccgccacaaatctcatgcttatgtga |
24847029 |
T |
 |
| Q |
120 |
ggatcaatgttggtcttgcattgtttgttgtttcgctcgtgatagttccactgcttgatgtggtttatgttaagggtagggttgggttgtataatgggtt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24847030 |
ggatcaatgttggtcttgcattgtttgttgtttcgctcgtgatagttccactgcttgatgtggtttatgttaagggtacggttgggttgtataatgggtt |
24847129 |
T |
 |
| Q |
220 |
ct |
221 |
Q |
| |
|
|| |
|
|
| T |
24847130 |
ct |
24847131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University