View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10950_high_9 (Length: 379)
Name: NF10950_high_9
Description: NF10950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10950_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 368; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 368; E-Value: 0
Query Start/End: Original strand, 1 - 376
Target Start/End: Original strand, 9539524 - 9539899
Alignment:
| Q |
1 |
agtatgagaaggctttgggattgtttatgaggatggaaagggagaaagatgtgagtccgaatgaagttacgttggcgagtgttttgccggcttgtgcgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9539524 |
agtatgagaaggctttgggattgtttatgaggatggaaagggagaaagatgtgagtccgaatgaagttacgttggcgagtgttttgccggcttgtgcgaa |
9539623 |
T |
 |
| Q |
101 |
tcttggagcacttgagattgggcagagggttgaagtatatgcgaggaaaaatgggttttttaagaatttgtttgtatgcaatgctgtgttggagatgtat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9539624 |
tcttggagcacttgagattgggcagagggttgaagtatatgcgaggaaaaatgggttttttaagaatttgtttgtatgcaatgctgtgttggagatgtat |
9539723 |
T |
 |
| Q |
201 |
gcaaaatgtgggaagattgatgttgcttggaaggtgtttgatgagatcggtagattcagaaatctgtgctcttggaattcgatgatcatgggtttggctg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9539724 |
gcaaaatgtgggaagattgatgttgcttggaaggtgtttgatgagatcggtagattcagaaatctgtgctcttggaattcgatgatcatgggtttagctg |
9539823 |
T |
 |
| Q |
301 |
ttcatggacaatgtcacaaggccattcagctttatgatcaaatgttggtaagctactcgttttacctgttattcat |
376 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9539824 |
ttcatggacaatgtcacaaggccattcagctttatgatcaaatgttggtaagctactcgctttacctgttattcat |
9539899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University