View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10950_low_11 (Length: 346)
Name: NF10950_low_11
Description: NF10950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10950_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 49412119 - 49411917
Alignment:
| Q |
1 |
caattttctactcccacaacacaacccatgttcacatacaatgacaaacaaaccccatcaaaaccctacaattttttgcctttcaaaccatcaaaaattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49412119 |
caattttctactcccacaacacaacccatgttcacatacaatgacaaacaaaccccatcaaaaccctacaattttttgcctttcaaaccatcaaaaattc |
49412020 |
T |
|
| Q |
101 |
aatatgaaaattccaagagccttggatgccgagttagtggagtttttgccgttccccacaaacatgccattaaccatattagaccaacaatttcaactct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49412019 |
aatatgaaaattccaagagccttggatgccgagttagtggagtttttgccgttccccacaaacatgccattaaccatattagaccaacaatttcaactct |
49411920 |
T |
|
| Q |
201 |
tgc |
203 |
Q |
| |
|
||| |
|
|
| T |
49411919 |
tgc |
49411917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 293 - 341
Target Start/End: Complemental strand, 49411827 - 49411779
Alignment:
| Q |
293 |
ttcgcctttatatacggcccatcatgtctccccttgtccctatgcttct |
341 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
49411827 |
ttcgcctttatatacgacccatcatgtctccccttgtccctaagcttct |
49411779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University